Sentence examples for discarded for further from inspiring English sources
The problematic arcs determined should be discarded for further analysis.
The pixel is discarded for further analysis if either constraint is not met.
Most of the sequence reads do not show SNPs between the parents and therefore were discarded for further analysis on AI.
Next, the Illumina adapter sequences (5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG) and (5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT) were removed using the fastx_clipper, which is part of the FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). Reads that were <32 bp in length were discarded for further analyses.
The filtering stage with a set of specific filters can be regarded as band-pass filtering, since only the components that match the set of filters are allowed (or not discarded) for further processing.
However, as discussed in [21], such kind of error seldom appears in natural images (about 1% of the image blocks have truncation errors), and any block with pixels having luminance value of 0 or 255 is discarded for further analysis.
These two genotypes were discarded for the further analysis.
These samples were discarded for all further tumor versus adjacent normal analysis.
Six additional volumes per session were acquired at the beginning of each series and subsequently discarded from further analysis to allow for steady-state magnetization.
Simulations were run for 10 million (1 million for nuclear markers) generations with trees sampled every 100 generations (100 000 trees saved) with the first 7 000 (700 for nuclear markers) trees discarded from further analyses (burn-in).
