Sentence examples for discarded for further from inspiring English sources

Exact(23)

The problematic arcs determined should be discarded for further analysis.

The pixel is discarded for further analysis if either constraint is not met.

Most of the sequence reads do not show SNPs between the parents and therefore were discarded for further analysis on AI.

Next, the Illumina adapter sequences (5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG) and (5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT) were removed using the fastx_clipper, which is part of the FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). Reads that were <32 bp in length were discarded for further analyses.

The filtering stage with a set of specific filters can be regarded as band-pass filtering, since only the components that match the set of filters are allowed (or not discarded) for further processing.

However, as discussed in [21], such kind of error seldom appears in natural images (about 1% of the image blocks have truncation errors), and any block with pixels having luminance value of 0 or 255 is discarded for further analysis.

Show more...

Similar(37)

These two genotypes were discarded for the further analysis.

These samples were discarded for all further tumor versus adjacent normal analysis.

Six additional volumes per session were acquired at the beginning of each series and subsequently discarded from further analysis to allow for steady-state magnetization.

Simulations were run for 10 million (1 million for nuclear markers) generations with trees sampled every 100 generations (100 000 trees saved) with the first 7 000 (700 for nuclear markers) trees discarded from further analyses (burn-in).

All read pairs for which no alignment was found were discarded from further analysis.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: