Sentence examples for directly downstream from inspiring English sources

Pollution would be limited to groundwater occurring directly downstream of the landfill site.

Primers phaZ3del3 and phaZ3del4 (Table 3) were used to amplify a fragment directly downstream of the phaZ3 gene.

Primer P2 (GGATGAATTC TTATTTCAGTCGGGACGGAAGTCGG) was chosen to bind directly downstream of the cphE stop codon and to introduce an Eco RI restriction site (underlined).

The amplified 3′UTRs were then cloned into the region directly downstream of a CMV promoter-driven firefly luciferase cassette in a pcDNA3.0 vector (p-Luc).

In this paper we overcome this heterogeneity, using engineered interferon derivatives with phenylalanine residue directly downstream of the N-terminal methionine (Met-Phe-IFN).

In contrast to TTS gene clusters in other bacteria, a putative gene homologous to the virB1 gene of Brucella suis was located directly downstream of bcscQR.

The gene directly downstream (SS02645) is annotated as a glycerol-3-phosphate dehydrogenase (glpC).

The rck operon is directly downstream of the pef operon that encodes plasmid-encoded fimbriae [23].

The BsrG1 site is located in the genomic sequence directly downstream of GAL2.

We therefore, considered these genes to be activated directly downstream P-Smad2/3.

P63, p73 and WT1 positively regulate transcription of Wnt4, while p21, directly downstream of Notch1 activation, negatively regulates transcription.