Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
We have so many problems that we have to solve like direction recognition, lane warning, lane detection, but all these obstacles have to be observed by camera systems in the urban environment, which is one of the biggest challenges.
Similar(59)
With modern industrial production develops toward the high speed and automatic direction, color recognition has been widely used in various industrial detection and automatic control field.
It made me realise that the bunch of managerial carrots which include positive assertions, directions, estimations, recognitions and, crucially, celebrations, was infinitely preferable to motivating sceptical, harried academics, or put upon administrators, with the flaccid stick of shame.
This is not to deny that its report is a small step in the right direction, and a recognition of the growing public interest in ecological restoration.
The shift in direction led to recognition, a recording contract, some truly original music and a devoted following, if not rock stardom.
Two armoured cars and a tank was seen to be moving towards the battalion from a different direction, reportedly sporting recognition signals of British First Army; Frost sent a party out to greet the vehicles, only for them to be taken prisoner and it to be revealed that the vehicles were German with captured equipment.
Here, we take a step in this direction, using olfactory recognition experiments after odor food associative learning in larval Drosophila.
The hCaSR sequence was FLAG-tagged in its C-terminal region using a reverse primer designed to contain, in the 5′ to 3′ direction, the XbaI recognition sequence, the wild-type stop codon sequence, the sequence encoding the FLAG peptide (GACTACAAGGACGACGATGACAAG), and the hCaSR sequence adjacent to the wild-type stop codon.
The staff saw themselves as the true implementers of the programme, while the CEOs were perceived to be best placed to offer assistance in the form of organisation-wide messages (statements of importance of the programme), recognition, direction and trouble shooting.
Given this system of compensated projection, the recognition of direction in relation to the individual is now feasible.
Two years later came the success of Women in Love, Russell's groundbreaking adaptation of the DH Lawrence novel, which won an Oscar for leading lady Glenda Jackson, as well as nominations for cinematography, screenwriting and direction (Russell's only recognition by the Academy).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com