Your English writing platform
Discover LudwigSuggestions(1)
Exact(2)
The picture remains indelible because of Mr. Loach's bold, direct framing of the narrative and the casual dynamism of its young star, Martin Compston, making his acting debut.
This picture remains indelible because of Mr. Loach's bold, direct framing of the narrative, and the casual dynamism of its young star, Mr. Compston, making his acting debut playing a teenager named Liam.
Similar(58)
I can assure you that I see this as a challenge, and I am proud that the Netherlands is now to lead the high-level group which is to develop a joint approach to both crime and drugs, and which can direct the framing of the joint action about which so much has been said.
When the transmitting STA of the connection has no direct data frame to transmit, the STA should use the granted transmission opportunity to transmit its null or data frame to the AP when polled by the AP.
These techniques could be applied to find transition points, which can aid in manual interpretation of the results, or potentially be applied to direct automatic frame capture.
When a group in consists of a single connection, the transmitting STA of the connection can transmit its direct data frame to any receiving STA of the established direct link connections in its transmission range when polled by the AP.
When all connections with a transmitting STA are separately in the different simultaneous polling groups, the STA can choose only one connection to transmit its direct data frame when polled by the AP.
When two or more connections with a transmitting STA are individually in the different simultaneous polling groups, the STA should choose only one connection to transmit its direct data frame when polled by the AP.
Presidents, Prime Ministers and senior cabinet members need to become personally involved: their leadership should be directed towards framing NCDs as an obstacle to national economic and social development, and to fostering an inter-sectoral, government-wide response [ 41].
"She is directing every frame of her music and her life, imagining how clips will appear on YouTube and what people will tweet after she appears on the VMAs," says Dumenco.
The transformation amplicon was generated by PCR using (TTGATCCTGCTTTTAACAATTTCGAATCGTTTGCGTAATTGAATTCGAGCTCGTTTA AAC) and (CCTCCTCTGGAGGCTTAATCTTAAAAAATTTCTTTAATCCGCACTGACGAGCGTAATCTG) using pFA6a-HIS3MX6-PGAL1-HA3 as a template, resulting in a transformation cassette directed in-frame to the N-terminus of Sec9p.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com