Your English writing platform
Discover LudwigSuggestions(1)
Exact(3)
The attorney general, as a condition of parole, shall direct and appropriate transition in consultation with the government experts, not to exceed one week.
But in the second case, it is the universal that is the direct and appropriate object of the intellect, because the intentional representation (species or intentio) produced by the singular in the soul is not formed or 'taken in' by the material intellect, as the only species present in the material intellect is the universal.
Articulate a complaint about a specific behavior and express your feelings in a way that is clear, direct and appropriate.
Similar(57)
The importance of direct, timely and appropriate feedback in self-regulated learning has long been recognised.
It is connected with other cortical areas and serves to link the present sensory experience to memory of past experiences in order to direct and generate appropriate goal-directed action [ 45, 46].
Her coffee-colored voice — elegantly focused, with a touch of earth — is both direct and insinuating, appropriate for the subtle surrealism of Debussy's "Chansons de Bilitis".
The HWB assessment generates reliable business focused health risk data that can be used to direct and target appropriate interventions within corporate populations.
Starting Monday, 28 January, Nick's new character, Verdito will make daily on-screen appearances encouraging change with brief, direct and age-appropriate messages that appeal to the Nick audience.
This starts with cultivating relationships throughout the corporation, as well as with customers, suppliers, and business partners, to identify business integration needs and opportunities and direct appropriate resources to them.
For transient transfection, human TRPC5 cDNAs was cloned into pEGFPN1 and point mutations were introduced using QuikChange® site-directed mutagenesis (Stratagene) and appropriate primer sets (forward (5′ 3′): GCTTTACTTCTATTATCAAACCAGAGCTATCGATG; reverse (5′ 3′): CATCGATAGCTCTGGTTTGATAATAGAAGTAAAGC).
"It means that they find it very hard to control the situation, to command and direct the appropriate response, and also to communicate from a position of strength," he says.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com