Sentence examples for digest replaced from inspiring English sources

For mass spectrometry analysis, an on-bead digest replaced the elution procedure: 500 ng LysC protease was added per 50 μl dynabeads in ammonium bicarbonate buffer and incubated at 37°C overnight.

Larval organs and appendages are digested internally and replaced by adult structures.

The corresponding NcoI-XhoI fragment containing the GFP ORF in pYL156-GFP was digested out and replaced with the GUS-intron fragment to create pTRV2-GUS.

The resulting plasmid pRap1a-nPK was digested with KpnI and replaced the ura4+ cassette at the rap1 gene locus in rap1∆ cells.

This digest was removed and replaced with DMEM + Glutamax (4.5 g l−1 glucose) supplemented with 10 mM HEPES, 50 μg ml−1 gentamycin, 5% v/v fetal bovine serum (FBS) and 0.04% w/v collagenase (Sigma) overnight at 37 °C with agitation.

The mutated fragment was digested with MfeI/Kpn I and replaced the corresponding region of pBD-TuMV-GFP to generate pBD-TuMV-GK.

The β2ADR coding region was replaced with NK1R by digesting both plasmids with SbfI and BamHI.

pCS-mCherry was digested with AgeI and SnabI to remove mCherry and replaced with amplified TdTomato-2A or TdTomato-m2A digested with the same enzymes.

This was digested with BamHI to replace [SM1]4 with the Vida3 tetramer cassette to produce pGEM-AgCP[Vida3]4 pGEM-AgCP[Vida3]4

Vav1-GFP constructs were generated by ligation of an XbaI-BamHI Vav1-GFP cDNA fragment into IRES-GFP-RV digested with XhoI-BamHI replacing IRES-GFP.

Specifically, mEos2 was amplified using primers GATCGAATTCATGAGTGCGATTAAG GATCCTCGAGTTATCGTCTGGCATTGTC, restricted with EcoRI and XhoI (underlined), and ligated into a similarly digested pET28-M13-rsFastLime pET28-M13-rsFastLime pET28-M13-rsFastLimet.