In brief, human CD4, HLA-DRA*101/HLA-DRB*0401 transgenicnsgenic (HLA-DR4trg) mice (devoid of I-Aβ) were immunized in the footpad with 50 μg of purified HC gp-39 mixed in incomplete Freund's adjuvant (IFA).
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
(A cavalier describing himself in relation to the woman he adores: "A simple soldier, quite devoid of wit/I find I'm in her presence, and that's it").
These were selected solely on the basis that the blocks were comparatively devoid of noise, i.e. there was no prior knowledge of which condition type they constituted.
We note that for all incubation times the bilayer surface was devoid of defects, i.e., holes in the upper monolayer or in the bilayer were never observed.
I have sat on my thoughts and words for a few hours now because, in all sincerity, whatever I see on my screen seems lifeless, devoid of everything I experienced in the company of these men.
As a result, the isolated Hp was devoid of apoA-I and was able to retain the biological function by forming an Hp hemoglobin complex.
This poem was written in memory of Richard Meier's colors: THE HALLWAY All clean, uniform and devoid of color Is Westbeth now a hospital, mental institution or a bland nightmare -- What happened to the creative colors?
As shown in the case with multiple deletions of mtDNA and complex IV deficiency, the mitochondria devoid of COX-I immunoreactivity in Pattern III lesions are likely to lack complex IV activity.
There on that empty beach, alone and devoid of thought, I saw one lone skeletal dog wandering down a stretch of sand along the water.
Importantly, the absence of ClpX reduced β-galactosidase activity expressed from the spa-lacZ translational fusion approximately 5 fold, both in wild-type and in cells devoid of agr/RNAIII.
