Three in-air pulsed septum magnets were developed to inject and extract electron beams for the 3 GeV synchrotron facility, the Taiwan Photon Source (TPS).
A variety of software and hardware systems have been developed to inject controlled electrical conductances into excitable cells, to investigate the physiological mechanisms of action potential generation.
New ruthenium dimers have also been developed to rapidly inject electrons into CuA of CcO with yields as high as 60%, allowing measurement of the kinetics of electron transfer and proton release at each step in the oxygen reduction mechanism.
Although Wilmut had little experience with genetic engineering and had limited enthusiasm for the project, he used his knowledge of developmental biology to obtain zygotes (one-celled embryos) from sheep and developed techniques to inject DNA into the zygote pronucleus (a haploid nucleus occurring in embryos prior to fertilization).
A novel experimental setup in which a glass microcapillary can be precisely positioned close to a metallic electrode has been developed to locally inject aggressive solutions at will.
A PCR assay was developed to genotype each injected clone of the library individually using one clone specific primer (Table S2) and the BGdown primer (AGCAATAGATGGCTCTGCCCTGAC) in the beta globin minimal promoter, which is common to all.
After sacrifice, bone cylinders (∅ 32 mm) were harvested throughout the tibia and femur by means of a diamond-coated core drill, which was especially developed to harvest the injected bone area exactly.
since Lauren stepped down, in 2015, said that the company planned to try "focussing on our icons" and "developing limited editions to inject energy and excitement into our brand".
He and graduate student Yun Yung developed a way to inject one of these lipids, lysophosphatidic acid (LPA), into the ventricles of a fetal mouse brain.
The administration is trying to develop a "standardized program" to inject capital into banks, with the government taking a non-voting stake in companies.
Originally developed to treat leukaemia, the injected drug targets specialised white blood cells that play a key role in the immune response behind RA.
