Sentence examples for determination of hours from inspiring English sources

Effect of Portal-to-Portal Act on determination of hours worked.

29 CFR § 790.5 - Effect of Portal-to-Portal Act on determination of hours worked.

§ 790.5 Effect of Portal-to-Portal Act on determination of hours worked.

Our analysis also points to several extensions that may help in explaining other features of the data, including the joint determination of hours and wages.

36 The determinations of hours worked under the Fair Labor Standards Act, as amended is discussed in part 785 of this chapter.

Determination of employment, hours of work, and wages.

The Institute has thereby accepted the principle of collective determination of wages, hours, and conditions of employment, to be exercised in accordance with the principles set forth in the bilateral, contractual agreements to which the Institute is a party.

Levels of mRNA were then standardized against 18s rRNA levels with primers 18SF: 5' CCCCTCGATGCTCTTAGCTGAGTGT 3' and 18SR: 5' CGCCGGTCCAAGAATTTCACCTCT 3', taking into account a previous determination of 65 hours for 18s rRNA half life [95], and plotted as the percentage of remaining mRNA compared to message levels at the 0 time point (where there is a 100% maximum mRNA level).

Importantly, developments in computing, automation and high-flux synchrotron sources have propelled the rapidity of 'conventional' RNA crystal structure determinations to timeframes of hours once a suitable set of phases is obtained.

Determination of employment, unemployment, hours of work, wages.

Therefore, we took three value pairs per parameter for each patient with a one-hour difference (9-10, 10-11 and 14-15 hours) for determination of the type of scatter and the one-hour coefficient of repeatability.