Sentence examples for detect replacements from inspiring English sources

Exact(1)

The protocol described below was designed to detect replacements only in the reverse orientation and solely on the basis of DNA structure.

Similar(59)

Within the bone, MR is able to sensitively detect replacement of high-signal fat and marrow cellular material by incipient metastases.

Mathematical models can be used to elucidate these contrasting outcomes, predict the conditions under which serotype replacement is likely, interpret the results of conjugate vaccine trials, design trials that will better detect serotype replacement (if it occurs), and suggest factors to consider in choosing the serotype composition of vaccines.

This study explores the ability of different methods to detect hormone replacement therapy (HRT -associated increases in breast density.

To detect marker replacement in standard SSG we used the following primers: CCGAAAACGTACGGCTAACT and AACGTTGTAAACGCAATCACC.

To detect marker replacement in gsSSG we used a 5' primer, CCGTACAGCTATCGTTTCAGG, together with two 3' primers, TAGTCCCTTTGCAGACATG and TCGCCTTTGTCGTCTAAACC.

These analyses should be conducted in specific geographical areas and should be aimed to evolution of IPD, by age groups, clinical presentation, and vaccine serotypes (and non-vaccine serotypes to detect possible replacement).

These analyses should be conducted in specific geographical areas and should be aimed to evolution of invasive pneumococcal disease (IPD), by age groups, clinical presentation, and vaccine serotypes (and non-vaccine serotypes to detect possible replacement).

We gathered two genome-wide detected nucleosome replacement data, the H3.3 replacement and the H2A.Z (also known as H2Av) map, to depict the nucleosome organization in the Drosophila genome.

It is important to note that the recombination detection algorithms do not detect the complete replacement of the analyzed fragment.

Unfortunately, the review was unable to detect prosthodontic tooth replacements and its potential influence on functionality.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: