Sentence examples for detect markers from inspiring English sources

Exact(34)

Multiple PCR assays for Y. pestis detection that primarily detect markers located on plasmids have been developed (1 – 6 ).

To identify this mechanism, we stained mouse liver sections to detect markers of various cell populations.

The sensor also can be used to detect markers of diseases other than cancer.

Immunohistochemistry was performed to detect markers of ER stress, renal damage and infiltrating cells.

With Barany and his team, the company has developed its pilot assays to detect markers of colon cancer and is currently working to apply the basic principles to other types of cancer.

After one day of drug exposure, the implant is removed, along with a small sample of the tumor tissue surrounding it, and the researchers analyze the drug effects by slicing up the tissue sample and staining it with antibodies that can detect markers of cell death or proliferation.

Show more...

Similar(26)

The microscope makes use of a filter cube to detect marker-specific fluorescence.

Then, a threshold in the Mahalanobis sense is applied to all images in order to detect marker locations.

A recombination rate heterogeneity test was performed to detect marker pairs with significantly dissimilar numbers of crossover events per meiosis in the alternative mapping pedigrees.

To detect marker replacement in standard SSG we used the following primers: CCGAAAACGTACGGCTAACT and AACGTTGTAAACGCAATCACC.

Thus, these results indicate that four samples may be enough to detect marker genes amongst the top correlated genes.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: