Sentence examples for designs applicable to from inspiring English sources

Exact(5)

Commercial digester designs applicable to the region include continuously stirred tank reactors and fixed film digesters.

In fact, the included papers address a variety of approaches, algorithms, and designs applicable to hearing instruments that are all amenable to DSP implementation.

Finally, the PDEs with unknown spatially varying coefficients and with boundary sensing are considered, making the adaptive designs applicable to PDE systems with an infinite relative degree, infinitely many unknown parameters, and open loop unstable.

A systematic literature review was performed to identify phase II trial designs applicable to oncology trials.

A systematic literature review was performed of phase II clinical trial methodology to produce a detailed library of available phase II designs applicable to cancer trials.

Similar(55)

Here we describe some of the fundamental aspects of formulation design applicable to virus-like-particle based vaccine antigens (VLPs).

The objective of this research is to develop and demonstrate an automated, cost-effective, and broadly applicable approach to groundwater remedial design applicable to contaminated aquifers in different geologic settings.

In addition, to make the control design applicable to realistic systems, with noise and disturbances in the measured signals, we consider a state observer.

These findings lay the foundation for a virtual approach to setting the processing cycles and materials design applicable to nanoscale powders.

Very often the research design applicable to conventional medicine does not apply to mind-body practices.

In order to make the SASI fragment design applicable to Nextera library preparation and PCR-based enrichment approaches, we added the sequences TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG and GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG, that are normally introduced via the Nextera reaction [ 33], to the respective 5' ends of forward and reverse primers used in SASI fragment generation.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: