Sentence examples for designed with the aid from inspiring English sources

Primers (FNR FP: 5'TGGTTTGGCATGGCTCTTCC3'; FNR RP: 5'ATCGTTTACTTGCTCTCTGCTTAC3'; Fld FP: 5'TTGATTATTGGCTGTCCTACTTGG3'; Fld RP: 5'CTGCGTAACCTATTTGGTCACC3') were designed with the aid of Beacon Designer 2.0 (PREMIER Biosoft International).

TaqMan probes were designed with the aid of Beacon designer 7.0 Software (Premier Biosoft, California, USA).

They were designed with the aid of a Broadway costume designer, Stev Taylor, for $60 to $70 each, Mr. Napolitan said -- a midrange price for high-end waiterwear.

Modern corn mazes are complex systems designed with the aid of sophisticated _________ programs.

Modern corn mazes are complex systems designed with the aid of sophisticated computer programs.

The communication mechanism is designed with the aid of cryptographic tools.

Mr Eliasson, known for his large-scale light installations such as the "Weather Project" at Tate Modern, says solar lamps "should not be designed with the language of the aid and relief industry".Demand for cheap, efficient lighting is only going to grow.

Contracted GTF basis sets designed with aid of the Generator Coordinate Hartree Fock (GCHF) method for H 2S), O2−(1S), and Cr3+(4F) atomic species are applied to perform theoretical interpretation of the Raman spectrum of hexaaquachromium III) ion.

On the basis of the BAC-end sequence, primer pairs were designed with aid of Primer3 software (http://frodo.wi.mit.edu/primer3).edu/primer3

Angus Jackson's production catches the propulsive excitement of a play that takes us from a Berkeley campus to a Pacific airbase and Robert Innes Hopkins's design, with the aid of overhead girders, even brings on stage the bomb – the so-called Fat Man – about to be dropped on Nagasaki.

We used a mixed method and multilevel sampling design with the aid of questionnaires and interviews.