Sentence examples for designed with aid of from inspiring English sources

Contracted GTF basis sets designed with aid of the Generator Coordinate Hartree Fock (GCHF) method for H 2S), O2−(1S), and Cr3+(4F) atomic species are applied to perform theoretical interpretation of the Raman spectrum of hexaaquachromium III) ion.

On the basis of the BAC-end sequence, primer pairs were designed with aid of Primer3 software (http://frodo.wi.mit.edu/primer3).edu/primer3

Robinson et al. (2006) demonstrated that provision of a self-help guidebook, designed with the aid of patients, reduced primary care consultations by 60% [ 31].

Finally, a frequency selective absorber made of RCC layers was designed with the aid of a numerical optimization tool (particle swarm algorithm); the discussion of results is supported by a finite element method analysis of the layered structure.

The dimensions of the platform and flexure hinges and the position of flexure hinges are designed with the aid of finite element modeling to provide good stiffness with little bending deformation of the platform.

The performance of the proposed model and the comparative analysis involving models designed with the aid of PSO and DE are presented in case of a nonlinear function and two Machine Learning (ML) datasets.

The microfluidic device was designed with the aid of simulation methods and consists of a chamber containing a densely packed alternating array of teardrop-shaped microstructures.

To demonstrate this possibility, ethane 1,2-diaminoborane (EDAB) was embedded on the C/SiO2 matrix at concentrations ranging from 11 to 31%wt using a wet impregnation method, and a device appropriate for hydrogen release from this material by application of microwaves was designed with the aid of a numerical simulation.

Primers (FNR FP: 5'TGGTTTGGCATGGCTCTTCC3'; FNR RP: 5'ATCGTTTACTTGCTCTCTGCTTAC3'; Fld FP: 5'TTGATTATTGGCTGTCCTACTTGG3'; Fld RP: 5'CTGCGTAACCTATTTGGTCACC3') were designed with the aid of Beacon Designer 2.0 (PREMIER Biosoft International).

TaqMan probes were designed with the aid of Beacon designer 7.0 Software (Premier Biosoft, California, USA).

A distance-dependent electrochemiluminescence resonance energy transfer (ERET) system based on CdTe nanocrystals and Au nanoclusters (Au NCs) was designed with the aid of ligase for highly selective detection of microRNA (miRNA).