Sentence examples for designed to proceed from inspiring English sources

Exact(6)

A group of five middle‐in come apartment houses are designed to proceed like steps from both sides of the island toward the center.

The Nuvola® system is designed to proceed through consecutive steps of a maximum of 12 aligners.

Because the assembly was designed to proceed in a branched fashion, the assembly of the three independent branches is not synchronized.

It is designed to proceed in the following manner: in the first run of WildSpan, the sequence of median length is selected from the input set as the query sequence.

Because all of the steps of EPL are designed to proceed in the presence of high salt concentrations, this approach avoids the technical hurdle caused by the decrease in the solubility of polyarginine fusion proteins when expressed in E. coli.

New primers were designed to proceed restriction endonuclease reaction (EGFR Sense: 5′CATGAGTACGTATTTTGAAACTC3′; and Anti-sense: 5′CACACACCAGTTGAGCAGGTA3′) and the PCR reaction was performed as follows: 25 ng of genomic DNA, 1X PCR buffer (Invitrogen, USA), 3 mM MgCl2 (Invitrogen, USA), 0.2 mM dNTPs, 0.5 U of GoTaq Polymerase (Promega, USA), 3 pmol of each primer up to 25 μL.

Similar(54)

By pre-establishing these "take-out" dimensions they perform an important function in allowing the standard piping system design to proceed long before the actual purchase of the components.

Allowing such research creates a double standard that allows research using unacceptable designs to proceed in developing countries.

Physical as well as socio-economic surveys will be required at this point (Step 2) to allow design to proceed.

The course was designed to enable students to proceed to an economics MSc, so it had a rough equivalence to an undergraduate degree (and was accredited as such by the university regulators).

This protocol is specifically designed to allow neighbors to proceed with parallel independent transmissions without waiting for the marker packet to arrive.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: