Sentence examples for designed to fish from inspiring English sources

Exact(5)

These are designed to fish from 60 160 km from shore.

The technological change in vessel construction and equipment facilitated the move toward a fleet of dedicated shrimp fishing vessels designed to fish in harsh conditions and spread fishing time over a longer period and a larger volume of landings which helped defray the initial capital cost and the annual operating costs.

Many anglers prefer to use baitcasting reels when fishing the Alabama rig, as those reels are designed to fish with the heavy lines the rig makes necessary.

Topwater lures are designed to fish on the surface, which diving baits usually feature a lip that causes them to dive below the surface when retrieved rapidly.

These plastic worms are thin, short worms of 3 to 4 inches (7.5 to 10 cm), designed to fish with light tackle in clear water conditions, such as those found in older reservoirs that have lost most of their grass and sunken timber cover.

Similar(55)

Various structures called fish passages are designed to get fish past dams, and they dot rivers across the Northeast United States.

Net means a seine, weir, net wire, fish trap, or other implement designed to entrap fish, except a hand-held landing net used to retrieve fish taken by hook and line.

While fishing gear is designed to catch fish and invertebrates, it also catches unintended species, including seabirds.

A pair of primers was designed to amplify fish TFEB mRNA from whole fish mRNA samples: upstream primer: ATTTAGGTGACACTATAGAAATGTCGTCACGCATCGGCCT; downstream primer: CCGCTCGAGTCACTGTATATC.

Fish collection or diversion facilities are structures designed to remove fish from a channel where they may be endangered from pumps, power plants, or irrigation systems.

In neritic areas, the abundance of associated fishes was quantified with a purse seine net designed to minimize fish avoidance of sampling gear.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: