Sentence examples for designed region from inspiring English sources

The surface of silicon wafer was initially coated with polyethylene oxide (PEO) to prevent the adsorption of DNA molecules and laser was applied for the designed region where adsorption of DNA is favored [ 19].

Site-directed mutagenesis of ARR22 was carried out on the ARR22 Entry clones using QuikChange® Site-Directed Mutagenesis Kit (Stratagene) and a pair of fully complementary primers for the designed region GGCGAAGCTAGCTTCGACCTTATTCTAATGGAGAAGG containing D74E mutation and NheI restriction site or CGACCTTATTCTCATGAATAAGGAAATGCCTGAG containing D74N mutation and PagI restriction site.

We present an effective method to assemble the PSs in specified regions by hydrophiling the substrate in designed regions for the nanophotonics with nanostructures in well-definite regions.

Further, ridge analysis was used for optimization of values in the experimental design region.

The clear peak in the response surfaces indicates that the optimum conditions were located in the experimental design region.

This can be done using a damping-dependent scaling factor appropriate for the seismological characteristics of the design region.

A technique is proposed for synthesizing pole-placement controllers capable of assigning the closed-loop poles of a family of plants inside a specified design region.

The response surface indicated a stationary point within the design region that was a saddle.

Here, |Ω| denotes the area (or volume) of the design region, and the displacement of a general point can be described in terms of u(x).

This approach adds significant value to method development by defining and understanding critical method attributes, critical method parameters, and method operable design region.

If no weather data is available for a particular regionl, it has to be taken from a design region and adjusted to all known local conditions.