The mutation-specific primers (Table 1) were designed to preferentially anneal with the targeted mutation nucleotide(s), thus having reduced affinity for wildtype sequences.
Protocols are designed to preferentially detect active Alu subfamilies.
Primers were designed to preferentially amplify DNA fragments of the generic allelic groups of the DQA1 and DQB1 loci.
For most samples, two primer sets were used, OXY107F/OXY1313R targeting oxygenic micro-organisms including cyanobacteria and PLA491F/OXY1313R designed to preferentially amplify photosynthetic eukaryotes, yielding 273 and 432 partial-length plastid 16S rRNA gene fragments, respectively (Table 1).
Capecitabine, a 5-fluorouracil (5-FU) prodrug, was designed to preferentially deliver active 5-FU to tumor cells.
Initial GWAS chips were designed to preferentially capture common genetic variation in Europeans [Rosenberg et al., 2010].
However, antisense RNA detection was limited in that study, because the protocol was designed to preferentially detect short RNAs.
For roots with RFLP patterns which did not match any database taxa, the nuclear ribosomal ITS region was amplified using the same PCR protocol as for the trnL intron but with primers ITS4 [ 9], and ITS1P (AACCTTATCATTTAGAGGAAGG), newly designed to preferentially amplify grasses but not fungi.
Oligonucleotides were preferentially designed based on a successful assay, followed by selection for coding sequences and underlying p-values.
The authors concluded that SPIONs designed for in vivo medical imaging applications should preferentially use a negatively charged or uncharged surface coating.
Thus, clinical measurements of IL-23 should preferentially be designed for specific detection of p19.
