Sentence examples for designed once again from inspiring English sources

The tone is less strident this year in Frieze's sinuous white bivouac, designed once again by the Brooklyn architectural firm SO-IL.

His critics did not, of course, make light of the failure of monsoon and harvest, but their point was that the weight of the taxes — especially the land-revenue and the salt tax (designed once again to favor British imports over domestic salt) — was so crushing that it reduced purchasing power to the point where modest but viable cultivators in bad years became destitute and, ultimately, starved.

We stroll through the gardens into a vast, Chinese- themed, tented dining room designed, once again, by Dante Ferettitti and built especially for the evening--complete with tufted ceilings, palm trees and lacquered red and black walls, recreating the exotic glamour of Shanghai in the 1920s.

Designed once again by Ashton Raggatt McDougall, the proposal was opposed by local residents and some council members, and ran into significant funding problems when the Federal Government decided not to provide funding.

Cars are becoming sexy again.The car may be the ultimate consumer good in a consumer age, but it is also increasingly a product of fashion as well as engineering, with design once again becoming crucial to brands.

John wrote on his Instagram page: "Big thanks to Stefano and Domenico for the apology over their comments about IVF children … We look forward wearing their designs once again".

Of course, all the credit for design once again goes to TCL on this one.

The new LifeBook T1010, T5010 full-featured handwritten notebook computer, using new Intel ® Centrino ® 2 processor technology, doubling enhance operational efficiency and also add a number of innovative design, once again proves that Fujitsu is the industry's handwritten notebook computer The best option.

From the retrieved two DNA sequences, a new primer set (F: AAGTATTAGATCGTTACGGCGATGGAC, R: CCAAGAACACCAATCGTGTTATCAAGG) was designed and once again sent to Eurofins Genomics together with genomic DNA.

For the past six years, NASA has been building a new launch apparatus designed to once again take us beyond Earth's orbit, to Mars, and beyond.

But moving to a 64-bit design will once again open the door to faster transaction processing, more complex simulations and more sophisticated graphics.