Sentence examples for designed immediately from inspiring English sources

If complex circuits need to be designed immediately, then it is very important to reduce the time taken to realize the model.

The Tupolev Tu-70 (NATO reporting name: Cart) was a Soviet passenger variant of the Tu-4 bomber (which was a reverse-engineered copy of the American-made Boeing B-29 Superfortress) designed immediately after the end of World War II.

Primers were designed immediately adjacent to the glucocorticoid response element: TGGCTCTTTGGCACTGAGTA (forward), and TGCAGTTTGAAATCCCAACA (reverse).

First, symbolic BST models can be designed immediately for a pathway system of any complexity.

One SNP primer for each gene was designed immediately adjacent to the SNP (either the 5' or 3' end).

To check if dispersed TCAST2 elements show insertion polymorphism among strains, we analyzed several loci using PCR primers designed immediately up- and downstream of the TCAST2 insertions, based on sequence data of GA2 strain.

Designers are concerned that their designs immediately project trustworthiness and credibility, which influence the subjective judgments people make about a web site or online product.

"It is designed to immediately put money into peoples' pockets and give them some confidence," he said.

"It is designed to immediately put money into peoples' pockets and give them some confidence," Mr Key said after a Cabinet meeting.

This exercise was designed to immediately identify any problematic or unclear guidelines, which were then corrected or clarified.

The TEQ interventions were designed to immediately transfer participants who met risk thresholds for tobacco counselling to target the identified relapse risk.