Sentence examples similar to designed for easy tracking from inspiring English sources

The sites are designed for easy ogling.

The pieces are designed for easy installation.

Plants were not designed for easy decommissioning.

The Kelsey-Hayes Shelter was designed for easy assembly.

Instant, perfectly sized storage, designed for easy access and easy clean-up.

The cREMaG system was designed for easy and continuous updates.

Machines must be designed for easy cleaning.

However, most are designed for easy removal.

Each kinase is V5-tagged at its C-terminus for easy tracking of expression.

Two primers, F and F2 (5' AGCAGGGTTTTCTTAATGCTC 3') were used for sequencing and loading of reactions onto alternate lanes for easy tracking.

This is a good idea as it allows for easy tracking of sales.