Sentence examples for designed for another satellite from inspiring English sources

Exact(1)

This detector was designed for another satellite and the updated variant of the TUS detector for a new platform is presented.

Similar(59)

Therefore, control methods designed for a satellite using two reaction wheels cannot be applied to three-axis attitude maneuver problems for a satellite using 2SGCMGs.

For example, the transmission mode I is designed for the single frequency network (SFN), such as the T-DMB in Korea, while the transmission mode IV is designed for the satellite DMB (S-DMB) [25, 26].

In the first place, this paper proposes two adaptive nonlinear control algorithms based on the sliding mode control (SMC), which are designed for small satellite attitude control system.

An electronic PCR was performed with the primers designed for rat Satellite 1 sequences.

Intron spanning primers were designed for the satellite cell markers Pax7 (Forward primer 5′gggattccctttggaagtgt3′, Reverse primer 5′cgcccattgatgaagacc3′) and NCAM (Forward primer 5′aagacgcagccagtccaa3′, Reverse primer 5′tgcttgatcaggttcactttaataga3′).

Goonhilly, a sparse heathland at Britain's most southerly point, could have been designed for satellite broadcasts by a benevolent god familiar with the nature of the radio wave.

A two degree-of-freedom signal-based optimal H∞ robust output feedback controller is designed for satellite formation in an arbitrary elliptical reference orbit.

This article describes the construction of the GEMTEC global empirical model of the total electron content in the ionosphere, which is designed for satellite radio navigation.

EclipseVED™, variable-emissivity ECD, is designed for satellite and spacecraft thermal control, using an active ECD system for long-wave infrared (LWIR) modulation and a passive cold mirror for solar rejection.

In this context, the trajectory generation techniques available to date have been designed for a servicing satellite, the attitude and position of which are actively controlled.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: