Sentence examples for designed adjacent from inspiring English sources

Interrogation primers were designed adjacent to each variant base to enable implementation of the SNaPshot™ assay (Life Technologies).

A flap was designed adjacent to a defect based on the amount of tissue that remained for reconstruction.

Single-base extension primers were designed adjacent to the SNP loci from one of the orientations (forward or reverse) if the sequences were appropriate.

Forward and reverse PCR primers were designed adjacent to or spanning several constitutive exons (See Additional file 5), and half of these primers amplified specific bands of differentially expressed transcripts (See Figure 2).

If one pier fails, the bridge is designed for adjacent arches to span the gap without collapse.

Among 90 Morton's amenities is a superbly designed library adjacent to the 24-hour doorman and concierge-staffed lobby.

Primers were designed to adjacent constitutively expressed exons, in some cases spanning a few flanking exons.

Primers were designed immediately adjacent to the glucocorticoid response element: TGGCTCTTTGGCACTGAGTA (forward), and TGCAGTTTGAAATCCCAACA (reverse).

One SNP primer for each gene was designed immediately adjacent to the SNP (either the 5' or 3' end).

Alternatively, at least one of the probes may be designed either adjacent to, or positioned over, the polymorphism for direct interrogation of the SNP.

We designed primers adjacent to codons 12, 13, 61 and 146 of the K-RAS gene, as these are the most common mutations in cancer.