Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
By pre-establishing these "take-out" dimensions they perform an important function in allowing the standard piping system design to proceed long before the actual purchase of the components.
Similar(58)
The Nuvola® system is designed to proceed through consecutive steps of a maximum of 12 aligners.
Because the assembly was designed to proceed in a branched fashion, the assembly of the three independent branches is not synchronized.
It is designed to proceed in the following manner: in the first run of WildSpan, the sequence of median length is selected from the input set as the query sequence.
Because all of the steps of EPL are designed to proceed in the presence of high salt concentrations, this approach avoids the technical hurdle caused by the decrease in the solubility of polyarginine fusion proteins when expressed in E. coli.
New primers were designed to proceed restriction endonuclease reaction (EGFR Sense: 5′CATGAGTACGTATTTTGAAACTC3′; and Anti-sense: 5′CACACACCAGTTGAGCAGGTA3′) and the PCR reaction was performed as follows: 25 ng of genomic DNA, 1X PCR buffer (Invitrogen, USA), 3 mM MgCl2 (Invitrogen, USA), 0.2 mM dNTPs, 0.5 U of GoTaq Polymerase (Promega, USA), 3 pmol of each primer up to 25 μL.
Legislators, some of whom were elected after the vote two years ago by pledging there would be no new taxes, would have to agree to raise that limit for design and construction to proceed.
Of course evolutionary biologists are equally fascinated by variants, and it is my hope that this review has shown how evolutionary biology and vaccinology have been intertwined since the inception of vaccination and how they must remain linked for vaccine design and deployment to proceed safely and effectively.
Although a computer can't replace the emotional impulse in gardening — the one that causes me to buy more buddleia than I need because its weepy branches lure butterflies, or crowd beds with pansies because their open, cheery faces remind me of my daughter — the design program allowed me to proceed with confidence.
It is a feedback loop that verifies each stage of design and provides confidence to proceed to the next.
"The language is clear--NASA has evaluated 2000 vehicle concepts over the past decade, and the rocket scientists and engineers have picked the design and are ready to proceed.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com