Your English writing platform
Free sign upSuggestions(1)
Exact(5)
Analysis of chaotic systems with multistability helps researchers in nonlinear controller design to modify the algorithms with reference to the parameter selections [54, 55].
It suggests appropriate flexibility "on" and "in" the first-of-a-kind design to modify the demonstration park development path in light of uncertainty realizations.
This rapid approach to building pathways aids in the study of metabolic pathway performance by providing a unique freedom of design to modify and control biological systems for both fundamental and applied biotechnology.
Our meticulously developed test set used a random case selection process within specific diagnostic categories and had a large sample size, allowing our study design to modify some of the problems inherent in previously reported observer variability studies.
The two amiRNA target sequences selected for primer design to modify pRS300 for silencing of the Rhg1 locus LRR-kinase gene were identical to Fayette chromosome 18 sequence as well as the paralogous chromosome 11 sequence from the Williams 82 genome: amiRNA GmLRR-KI: TAAGACTATAAGGGATTGCTG; and amiRNA LRR-KII: TAAGACTATAAGGGATTGCTC.
Similar(55)
According to the company's history, Hughes Aircraft was designed to modify state-of-the-art military aircraft for racing.
In October 2006, at the annual statewide meeting of the Grand Lodge in Wheeling, when his tenure was about to end, Mr. Haas presented a bloc of amendments designed to modify rules that no longer made sense (if they ever did).
To solve this problem our study was designed to modify Gomori's method.
The present study tested an intervention designed to modify proactive interference control clinicaltrials.gov identifier: (NCT02139137).
Attention bias modification (ABM) is designed to modify threat-related attention bias and thus alleviate anxiety.
In this paper, a porous carbon nanowire (N-PCNW) is designed to modify the separator.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com