Sentence examples for design disruption from inspiring English sources

Exact(2)

To this purpose machine learning methods have been widely studied to design disruption prediction systems at ASDEX Upgrade.

Based on the densely mapped SNP information from the present study, it will be possible to design disruption and reconstruction of existing consensus haplotype blocks [ 44] to generate novel haplotype blocks with new variations (i.e., to perform haplotype shuffling).

Similar(58)

The program loses control, creating design disruptions in the final patterns (and logos).

Despite a wealth of literature on supply chain design with disruption considerations, to the best of our knowledge there is no state-of-the art review on supply chain with disruptions and recovery considerations.

This highlights the importance of considering the broader economic benefits of diversified chains, leading to risk reduction and improved design post-disruption.

The application of a newly available version of NIMROD, with more complete atomic physics, shows promise in matching the experimental trends and could be an invaluable tool for increasing our confidence in designing efficient disruption mitigation for ITER.

Table 2 Target sequences used in this study Name Sequence (5′ → 3′) gRNA-1 TATAAAATGTCGCTGTGACC gRNA-2 CAACTACAACCGGATACCTG gRNA-3 ATGGAAGCAAGAGGGAGTAT Fig. 1 Design of INU1 disruption and replacement.

The knowledge of solubility of different gases in triglycerides is required to design efficient cell disruption processes for biodiesel production from wet biomass.

The "ipsilateral/contralateral disruption design" employed here virtually rules out the possibility that the suppressive effects of the lesions were nonspecific and suggests that the VPm and LH play essential roles in mediating the ingestive effects of inactivation of the AcbSh.

May's plan included "extremism disruption orders" designed to be used against non-violent "individual extremists who incite hatred".

Overcoming these constraints secure a relatively higher prominent position in the entrepreneurial agenda, in comparison to designing innovation and bringing disruption.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: