Sentence examples for design and quantitative from inspiring English sources

Exact(18)

He teaches courses in transportation research design and quantitative reasoning and statistical methods for planning.

Chip design and quantitative interpretation of the data are based on a theoretical optical model.

In completing his Master in Public Health coursework at the Harvard School of Public Health, he has learned techniques in study design and quantitative methods.

Lab modules build upon current research including: gene and genome engineering via decoupled design and construction of genetic material; component engineering focusing on molecular design and quantitative analysis of experiments; device and system engineering using abstracted genetically encoded objects; and product development based on useful applications of biological technologies.

A focused and rapid microwave-assisted extraction (MAE) process was carried out and optimized for secondary metabolites from crustose lichens using Taguchi experimental design and quantitative analysis on TLC by a Camag® spectrophotodensitometer.

In this minireview, the role of metabolic modelling in synthetic biology will be discussed with a review of current status of compatible methods and models for the in silico design and quantitative evaluation of a cell factory.

Show more...

Similar(42)

Much of the recent literature in the field of stuttering has a primary reliance on experimental designs and quantitative analysis.

Specific primers were designed, and quantitative RT-PCR experiments were performed to increase the sensitivity of detecting isogenes with a low expression level.

In order to assess transcript levels by RT-qPCR, specific primers for the PopTLP1 gene (Poptr_0001s09570 in P. trichocarpa genome; 5' CCAGACTTGGTATCTTAATG; 3' GTTACCAAACTGATTTAACG) were designed and quantitative PCR was carried out as previously described [ 63], with technical and biological duplicates.

Design: Descriptive and quantitative kinematic analysis.

Design: Narrative and quantitative summary of review findings.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: