Sentence examples similar to described previously located from inspiring English sources

As described previously [30], particles located within a circle, 30 µm in diameter, centered on the nucleus were deemed perinuclear, while particles outside of this region were deemed lamellar.

The primers, which have been described previously (8 ), were located near the 5′ terminus of the gene encoding the SNV N antigen.

1 µg of RNA from each sample was submitted to one step RT-PCR (OneStep RT-PCR, QIAGEN) using primers located in exon 9 and 12 of lamin A (forward primer: 5' GGCTGCGGGAACAGC 3', and reverse primer: 5' CTGGCAGGTCCC 3') described previously [38], together with primers located in human β actin isoform (Forward: CCCAGCACAATGAAGATCAA and reverse GTGTAACGCAACTAAGTCAT) as internal control.

Two pairs of genes responsible for anthranilate biosynthesis had been described previously: phnAB (Essar et al., 1990a), located adjacent to the pqs operon (Gallagher et al., 2002), and trpEG, which encode enzymes involved in tryptophan biosynthesis (Essar et al., 1990b).

Data analysed were extracted from the databases of PBCRs located in major Brazilian cities as described previously [ 10].

For the brain we averaged the activity in ROI located in cortical, subcortical and cerebellar regions as described previously [35].

Acupuncture points were located based on the measurement of body length as described previously.

as described previously [27].

Essentially as described previously [57].

route as described previously [27].

Imaging was described previously [26].