Sentence examples for described n from inspiring English sources

From Tg and WT mice, messenger RNA (mRNA) was extracted as previously described (n = 8/group) and amounts of OCT1, OCT2, and MATE1 were measured [14].

Targeted sequencing of the Gag gene for other study participants was performed likewise (n = 36) [22] or by population sequencing as previously described (n = 141) [34], [35], [35].

To determine the effects of PTBP1 on transcript half-life, HepG2 cells were transfected with either a non-targeting siRNA control or PTBP1 specific siRNA as previously described, n = 12.

Age in days was centred and scaled according to the mean and SD of the data used (for reference, mean  = 709.60, SD = 291.10 for data currently described; n = 11,928) and a polynomial regression was fitted.

Oxygen consumption (VO2) and carbon dioxide production (VCO2) were measured for 24 hours of fed and 24 hours of fasted conditions using a comprehensive laboratory animal monitoring system (CLAMS) equipped with an Oxymax Open Circuit Calorimeter (Columbus Instruments, Columbus, OH) as previously described (n = 8/group) [20], [20].

Y = Yes (clearly described) N = No (Not described) ?

These hybrid molecules were obtained as close analogs of previously described N-benzyl derivatives and fuse the chemical fragments of clinically relevant antiepileptic drugs such as ethosuximide, levetiracetam, and lacosamide.

The N-GFP::HA::CENPCΔ890/943 deletion mutant was generated by PCR starting from the described N-GFP::HA::CENPC full length construct using as primers the following oligonucleotides: NGFPCENPCPst1F: GGGCTGCAGACCATGGTGAGCAAGGG and CENPC889ER1R: CCGGAATTCTCATATATCCTGGCCAAC.

Prohepcidin signal was detected through two independent, previously described N-terminal prohepcidin antibodies [19] in combination with alkaline phosphatase-coupled secondary antibody and visualized with nitro blue tetrazolium and 5-bromo-4-chloro-3-indoyl phosphate (Sigma).

Three of the "social science" studies described n-of-1 clinical case studies [ 62- 64].

Motifs were then extracted according to the described n-gram methodology.