In terms of the iterative process of including sub-models the different elements of the final system matrix (5) A = = a 1, 1 a 1, 2 ⋯ a 1, N s a 2, 1 a 2, 2 ⋮ ⋱ a N s, 1 a N s, N s describe forward, local feedback and global feedback connections.
In the third section, we describe forward-type ascending and backward-type descending connections in the visual system, and use these features to furnish 'tests' for forward and backward connections in the motor system.
This is known as floating, and with the described forward addition as Sequential Forward Floating Search.
This polymorphism was amplified using previously described forward primer (19F) [16] and new designed reverse primer (19R2: 5'-GCA GGG TCT AAG CAG CAG CTA CTA').
We related p− and τ to the rate constants describing forward and reverse motion, k F and k R (Norstrom et al., 2010; see 'Materials and methods').
Control (sk) and gene-specific (Slimb) double-stranded RNA (dsRNA) was generated using the following previously described forward and reverse primer pairs (Buster et al. 2013); sk (5′CGCTTTTCTGGATTCATCGAC, 5′TGAGTAACCTGAGGCTATGG), Slimb (5′GGCCGCCACATGCTGCG, 5′CGGTCTTGTTCTCATTGGG).
We note that the '780 patent describes "forwarding a service request from the client to the server and appending a session identification (SID) to the request and to subsequent service requests from the client to the server within a session of requests". Id. at col. 3, ll.
For example, United States Patent No. 5,708,780 ("the '780 patent") (a reference cited by BN which is discussed more fully below), describes "forwarding a service request from the client to the server and appending a session identification (SID) to the request and to subsequent service requests from the client to the server within a session of requests". See '780 patent, col.
In addition to the validation of the framework to broaden its usefulness, the prediction accuracy could be improved by explicitly considering both time and motion in the models describing forwarding and waiting.
Herrera uses the word sabiduría to describe the forward.
Both the isolation and insertion loss describe the forward power transmission, S21, of the switch.
