We extracted all the octapeptide cleavage sequences from these natural substrates and made a query set which we call the NQSS (Naturally derived Query Sequence Set; Table S1).
In this study we reproduced the evaluation of Sanders et al[47] and derived pharmacophore queries from the crystal structure of CDK2 (PDB:1AQ1).
In spite the fact that a number of personalization approaches today use the notion of context, such 'context' is usually derived from queries and retrieved documents and/or inferred from user actions.
Given believable candidate genes, derived from queries of available data at Entrez Gene and PubMed, we continued the analysis using DAVID, PDG-ACE, and MetaCore (GeneGo, Inc). to understand how these candidate genes may be related to the etiology of AUD, depression, and comorbid AUD with depression.
A relevance query is a SPARQL SELECT query derived from the input query based on the concepts embedded in its clause formulation, and its execution over ({mathcal{G}}) returns all conceptually relevant data sources.
A breast cancer-associated gene list was derived by querying the Affymetrix EASI® Database U95A, with 'breast' as a search term.
We have presented SPIED results for drug perturbagen induced profile queries and queries derived from disease states.
These queries were derived from the Snort query base6 employing the following procedure: We removed the queries consisting of filters that either require more than one network packets to be checked or consider general characteristics from the packet flow, such as the total number of remote login failures.
When multiple queries are available, we find that a fingerprint averaged over all query molecules is generally superior to fingerprints derived from single queries.
When equivalent motif queries derived from the KSHV-miR-k12-11 KSHV-miR-k12-11 KSHV-miR-k12-11 KSHV-miR-k12-11to query the equivalent Kseedmiregion11 transfected dataset no significant peaks coUUAAUGCUUAGCCUGUGUCCGA
We repeated our experiments using a set of queries that do not share a theme--i.e., using queries derived from the Misc Dataset (Table 1).
