The additional sequences of the long and short insert libraries from the Sanger sequencing (Table 1) also served to mitigate this deficiency, and the extra Sanger sequences derived from the short insert libraries were used to correct for 454/Roche technology intrinsic errors.
Briefly, the sequences derived from the short-insert libraries were decomposed into k-mers to construct the de Bruijn graph, which was simplified to allow connection of the remaining k-mers into contiguous sequence (contigs).
PK parameters for each compound under study were obtained from previously published population PK studies in critically ill patients, except for f u, which was derived from the package insert for each drug; the mean and standard deviation for each of these parameters have been previously published[ 5, 7].
The primers TTCACATTGCATGTGTGTGG and TAGCCTGCGTAGTGTTGGTG amplify a 423 bp fragment from the normal sirt1 allele while a 526 bp fragment from the null allele is amplified from the first primer and ATTTGGTAGGGACCCAAAGG, a sequence derived from the pgk-1 gene inserted to create the null allele by homologous recombination.
To determine whether RAD27, END3, and PKC1 regulate the stability of a variable repeat minisatellite tract, we utilized the previously described ade2 -h7.5 allele (Kelly et al. 2011), which contains seven and one-half repeats of 28 bp derived from the human HRAS1 minisatellite inserted into the ADE2 gene at the XbaI site.
A "true" selection should be manifested by clones containing different inserts derived from the same gene (overlapping inserts).
She said that the word 'nduja, like the similar-sounding French word andouille, is derived from the Latin inducere, to insert.
The digestion patterns of iREX/BAC1 were identical to those of the original BAC clone, except for the fragments derived from the ends of the insert.
The cloned inserts were further confirmed by Southern blot analyses using the original BAC clones as probes; the results indicated that the digest patterns of the BGM recombinants were identical to those of the original BAC clones, except for the fragments derived from the ends of the insert.
Replication-deficient lentivirus pLenti6-hAR was derived from inserting the human AR full length wildtype cDNA into the pLenti6.2 plasmid (Invitrogen).
