Suggestions(1)
Exact(1)
In order words, the K-SPI-Stroke questionnaire does not discriminate YDP among the four patterns because in TKM, YDP simultaneously includes a Heat element of the FHP and a deficiency element of the QDP.
Similar(59)
This sequence is the core binding site of IDEF1 (iron- deficiency responsive element-binding factor 1), a transcription factor of the ABI3/VP1 family involved in Fe-deficiency response in rice [ 30, 54].
High IRO2 levels in rice result from the action of the up-stream iron deficiency responsive element-binding factor 1 (IDEF1)[ 42, 43].
Precise deletion and mutation analyses using numerous lines of transgenic tobacco identified the novel Fe-deficiency-responsive cis-acting elements, iron-deficiency-responsive element 1 and 2 (IDE1 and IDE2; [24]); these are the first identified elements related to micronutrient deficiencies in plants.
The motif contained the last 8 bp of a Zn-deficiency response element (ZDRE; ATGTCGACA); a cis-element responsive for Zn deficiency (Assunção et al. 2010) yielded the thirteenth highest MAMA score (Figure 4A, Additional file 7 online).
We reported that Fe deficiency-responsive element 1 (IDE1: ATCAAGCATGCTTCTTGC) and IDE2 (TTGAACGGCAAGTTTCACGCTGTCACT) were critical cis-elements for several genes upregulated by Fe deficiency (Kobayashi et al. 2003).
Iron-deficiency responsive element 1 and 2. IDE1-binding factor and IDE2-binding factor.
While soils in this region generally have lower concentrations of Co, Cr, Cu, Mn, Ni and Zn than soils in most of western and central Europe, it was difficult to find documented deficiency of elements other than Cu and Mn among those that are essential to plants.
Deficiencies in elements of a culture of care based on proper respect and involvement of patients and relatives.
The Pi deficiency-responsive elements in EgPHT1 includes the P1BS, W-box, E-box and the G-box.
As promoters of OsZIFL genes are enriched for Fe-deficiency cis-elements, we submitted rice plants to Zn-excess (200 μM) for three days and to Fe-deficiency (no Fe added to nutrient solution) for seven days.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com