Your English writing platform
Discover LudwigSuggestions(1)
Exact(36)
After initial denaturing at 94°C for 4 min, 3-step cycling for 35 amplification cycles were completed each consisting of 1 min at 94°C, 1 min at 58°C and 2 min and 30 s at 72°C.
After initial denaturing at 93°C for 5 min, 3-step cycling for 30 amplification cycles were completed each consisting of 1 min at 95°C, 1 min at 64°C and 2 min at 72°C.
Eisf1 (5′ GCCATGGGACCGGTACTTGC) and Eisr1 (5′ GTAGATGCCGCCCTCGCTAG) for the eis gene was the second primer used to amplify resistant genes to second line drugs with initial denaturing at 94°C for 4 min, 3-step cycling for 35 amplification cycles were completed each consisting of 1 min at 94°C, 1 min at 54°C and 2 min and 30 s at 72°C and a final extension of 10 min at 72°C.
The durability of the TiTaOx-based catalyst was assessed by potential cycling between 0.6 and 1.2 V vs. RHE, bubbling He, until 5000 cycles were completed.
The process was repeated until 1000 cycles were completed.
A total of 23 TVS cycles were completed.
Similar(24)
This cycling continues indefinitely until an entire cycle is completed in which none of the window positions move.
The life cycle is completed in one year.
When humans or other vertebrates swallow the raw fish, the cycle is completed.
The cycle was completed against Italy, the same team against whom it had all begun.
It was a cycle being completed, a gift from my dad, a song written about his dad.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com