HP's retail photofinishing Photosmart Studio, announced last week, also specializes in creating high-quality affordable custom options, including bound photo albums, large prints and collages.
Being a jazz musician, he's bound by custom to celebrate this mile marker on the bandstand, aglow in retrospection.
For many years the seniors in Syracuse University's marching band, for example, have been bound by custom to abandon their band shoes in some spectacular, public way after the last performance of their careers as a rite of passage.
I will not be bound by tradition and custom on this occasion".
"Gates is a casual man who's not bound by customs so he shakes hands in this manner even when meeting heads of international organisations or top political figures".
The amplified DNA fragments were sequenced on a single end Illumina flow cell using the Genome Analyzer II (TUCF Genomics, MA), for 51 cycles with custom primer which binds to IRR (pSAM3 -5' ACACTCTTTGACCGGGGACTTATCATCCAACCTGTTA 3') of the transposon DNA and the standard Illumina index sequencing primer.
The top third of the Elite is a 2.4in colour touchscreen for choosing devices, selecting favourite channels or activities, or for setting off custom commands that are not bound to physical buttons.
Without such a policy it will be at your employer's discretion as to how reasonable they are prepared to be, although they will need to adopt a consistent policy with all staff and could be bound by previous custom and practice.
Non-Jews, naturally, are not bound by these customs, but many follow them out of deference.
A storage buffer for goods bound for another customs entity.
In America, New York and the Atlantic can be thought to look back, forever bound to the customs of England, Europe, and the past.
