Sentence examples for current release as of from inspiring English sources

Suggestions(1)

Exact(1)

489 FGROUP entries were assigned for the current release (as of January 1 , 2007.

Similar(59)

Approximately 53% of the Protein Data Bank (PDB) [ 4] entries are classified by the current release of SCOP (1.75) as of April 2011, and after removing redundancy (sequence similarity at 90%), the coverage drops to about 41%.

Hereby we refer to the current release of RefSeq annotation as the original annotation [RefSeq: NC_004431] for CFT073, although the very first annotation in 2002 has already been updated with some minor corrections.

As the current release of the dolphin genome has only 2.59× coverage, there are limitations for comparative genomic analyses, especially the detection of positive selection.

In view of this situation, we suggest an evaluation structure heading for presenting (i) the advantages introduced by our proposal in one of the potential applicative scenarios (e.g. phenotype-based annotation of a rare disease) and (ii) the benefits of using the automated annotations in revising current releases of curated annotations as well as the annotation ontology.

The majority of genes without homologs in distant drosophilids have evidence for transcription and are annotated as genes in current release of FlyBase, and apparently represent genuine gene models.

The current release of miRBase contains a sequence annotated as miR415 with two entries, one in A. thaliana (aacagagcagaaacagaacau) and another in rice (aacagaacagaagcagagcag).

The current release of ACToR contains nearly 560,000 chemical entities (as defined by CASRN) and content from roughly 2700 data collections.

The current release of the database contains full-length cDNA and protein sequences downloaded from GenBank as of July 2013.

The current release of Shape meets those goals very well.

The current release of SCOPPI contains 63 such families.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: