Sentence examples for culture integrity from inspiring English sources

Exact(6)

S.&P. says the excerpts were taken out of context and "are contradicted by other evidence, and do not reflect our culture, integrity or how we do business".

"What underpinned Mitch's project," says Bain, remember his recruitment in 2014, "was that he talked about culture, integrity, and how he wanted to develop the professionalism and put in some of the characteristics of a large European football club".

S.& P. said that there was a robust internal debate about how a rapidly deteriorating housing market might affect the C.D.O.'s, "and we applied the collective judgment of our committee-based system in good faith," adding, "The e-mail excerpts cherry-picked by D.O.J. have been taken out of context, are contradicted by other evidence, and do not reflect our culture, integrity or how we do business".

We evaluated culture integrity and variability by microscopy, and measured the fractions of floating dead cells (by trypan blue staining) in each condition over several days.

There were no apparent qualitative differences in culture integrity or variability, and no quantitative differences in floating dead cells amongst the 70 %, 50, and 30% v/v MPE-fluid conditions.

Chemostat culture integrity was checked periodically by microscopy and PCR amplification and sequencing of the 16S rRNA gene using forward sequencing primer AGAGTTTGATCCTGGCTCAG and reverse sequencing primer GGGCGGTGTGTACAAGG.

Similar(54)

Transepithelial electrical resistance (TEER) was measured as a marker of co-culture integrity and as a measure of paracellular permeability.

In his introduction to the firm's Code of Business Conduct, Chairman and CEO Muhtar Kent lauds the company's "rich culture of integrity and ethical conduct" and points out that "[a]cting with integrity is about more than our Company's image and reputation, or avoiding legal issues".

"From the beginning, we have sought to build a culture of integrity and respect, and today's changes are just one more step to drive belonging and integrity in our workplace".

The 1993 study suggested that cheating dropped in schools that encouraged a culture of integrity — either by formally instituting an honor code or by stressing at every turn the importance of honesty and integrity.

It is time for leaders to step up, lead by example, and cultivate a culture of integrity.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: