Sentence examples for creation of a sequence from inspiring English sources

The first phase of scenario development involves the creation of a sequence of steps, relying on HealthFlow's external applications.

The programmable and robotic control of the COD platform allows the creation of a sequence of microfluidic aqueous segments with defined volumes, frequencies, and interdroplet spacings.

In cases where a 650 bp product was not successfully generated, internal primer pairs (LF1 ANTMR1-(see Table 1)) and (MLF1 – GCTTTCCCACGAATAAATAATA [11] – LR) were employed to generate shorter overlapping sequences that allowed the creation of a composite sequence (contig).

Specimens that were still recalcitrant were then amplified with the primer combination LepF2 (or C_tRWF_t1) with MHemR and MHemF with LepR1 to generate shorter overlapping sequences that allowed the creation of a composite sequence.

He argues for the creation of a "genetic sequence right".

The creation of a time sequence for the set of available collection of industrial accident data x^{o} = (x_{1}^{o},x_{2}^{o},x_{3}^{o}, ldots,x_{n}^{o} ) (2)   2.

The creation of a unique sequence tag results in highly sensitive and specific discrimination of parental JFH-FNX and modified clones using distinct probes in a RT-qPCR allowing for comparison of the effect of drug resistance or immune escape mutations on HCV replication.

The first step in the algorithm is the creation of a background sequence to compare with the human genome.

The creation of a multiple sequence alignment is a routine step in the analysis of homologous genes or proteins.

This process involves the creation of a "canonical" sequence, which is displayed by default in the entry.

The creation of a comprehensive consensus sequence database for Pinus species, the design and construction of a microarray platform from this database, and the use of this microarray platform to monitor and characterise the transcriptomic response of P. radiata saplings to ethephon will be described.