Your English writing platform
Discover LudwigExact(1)
This interface is created for the fusion of CT and MRI image using wavelet transform.
Similar(59)
The large helical device (LHD) is a superconducting magnet system, created for the performance of plasma-fusion experiments, with an operation time of over a half-year for one cycle and long discharge being one of its main missions.
In one scene she prepares the marine for his transformation into an "avatar" – a hybrid being that is created from the fusion of his genetic material with that of the alien humanoids who populate Pandora.
Wexler was shrewd enough to step back and allow Charles's extraordinary talent to express itself in a stream of hits that included It Should Have Been Me, This Little Girl of Mine, Lonely Avenue, and the two records in which Charles created the formula for the fusion of gospel and R&B that became soul music: I Got a Woman and What'd I Say.
The iPad application created for "Biophilia" is a successful fusion of visual design and conceptual seeding that turns every song into a starting point for extended play.
This range of distances, up to 15 nm, is considered to be the limit for the adhesion event that creates the fusion between the vesicle and the presynaptic membrane that can lead to exocytosis [ 24].
For three other assayed genes with only nested alternative transcripts, sox-2, dmd-6 and pes-1, the expression pattern appeared to be the same for all recombineered reporter gene fusions created for each (WBIDs Expr9798/9801/9841, Expr9817/9820/9821 and Expr9729/9753).
While Holly churned out country standards for the good people of Lubbock, they were already flirting with black R&B, a flirtation that would eventually create the fusion that would be rock'n'roll.
The advent of integrated PET-CT systems has created opportunities for fusion of PET data with these 3D CT imaging techniques (Fig. 4).
The final catalyst for the fusion which created jazz was cultural – the coming together of black and Creole musicians in New Orleans.
Prior to subcloning the Myo7a gene, the correct frame for the fusion was created by modifying the pDsREDMonomerC1 polylinker at the XhoI/SalI site by cloning the two annealed oligonucleotides as a double stranded DNA fragment: 5'TCGAGCCTCAAGCTTCGAATTCAAAAAA G 3' and 3'CGGAGTTCGAAGCTTAAGTTTTTTCAGCT5'.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com