Sentence examples for create a tag from inspiring English sources

A Twitterer called dmaul53854 announced his plans to lift weights and "get ready for some #Lost awesomeness!" using the pound sign to create a tag to make his tweet easier to find.

With this application, a student can easily create a tag on which an opinion is written.

For instance, you can create a tag for family members, another one for colleagues and another one for friends.

Subsequently, the Illumina adaptor 2 (sense: 5'GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG3') was ligated to the 3' ends of the tags to create a tag library.

After digestion with MmeI, which recognises the junction between Illumina adaptor 1 and the sequence CATG, 21-bp tags containing adaptor 2 were ligated to the 3' ends of the tags to create a tag library.

Therefore, try to create a "tag" or nickname that you can use on dating sites.

Events include a bell ringing parade in the East Village; a High Line Soundwalk; Phil Kline's popular "Unsilent Night" in Fort Greene; and Bach on the G train — during which string players will step in and out of train cars to create a tag-team rendition of the Prelude from Bach's Cello Suite No. 1.

When tagging, the system guides the depositor through a step-by-step process to create a tagging template by selecting the tags and the entities to be tagged.

In a short essay, which was reposted about 1,500 times, Mr. Divers wrote that he was intrigued by the fact that Momo had created a tag so large that it was, in effect, hidden, because it could not be viewed in its entirety.

Since TweetDeck already creates a tag cloud based on the most common subjects Tweeted about in any given list, it matches the categories to the tag clouds.

At the end of the workshop, he scanned the images and created a tag.