Sentence examples for create a construct from inspiring English sources
Cartilage tissue repair procedures currently under development aim to create a construct in which patient-derived cells are seeded and expanded ex vivo before implantation back into the body.
The CW's modern Archie-verse adaptation reimagines the 70-odd year-old comic for a new generation, using the classic characters and locations to create a construct of small-town America the series then sets about deconstructing.
When the user has mastered the full power of both of their eyes, regardless of what kind of Mangekyō abilities they have, the user gains the ability to create a construct of chakra called a Susanoo that provides defense and offense.
The pET system [pET22b] (Novagen) was used to create a construct expressing the ATPBD with a C-terminal His-tag.
Purified PCR amplified fragments were fused by overlap-PCR [ 99] to create a construct consisting of all fragments.
Primers were design in order to create a construct of HsAPC-1 to include just the regulatory domain and the linker region (residues 14 to 174) of the protein (Forward primer: GAAGGTAGAACCTCCGAAGA. Reverse primer: CCTAGGTCTAGACTCGAGTCATTATTATATATCAATACCTGTGGAATGTTT).
This creates a construct with four strands exiting the skin in 1-cm increments and placed to capture as much of the retinaculum and capsule as possible (Fig. 3c).
To achieve constitutive GFP expression, we created a construct where GFP is under the control of the actin promoter and tryptophan terminator.
In order to analyze the effects of ΔMosec22 gene deletion, we created a construct of the targeted gene deletion vector pMD-MoSEC22 KO by inserting the HPH gene expression cassette into the two flanking sequences of the MoSEC22 gene.
Removing these 13 amino acids from Sryα, creating a construct known as Sryα(del), decreased promoter activity compared to the wild type Sryα yielding similar values as Sryβ.
We created a construct where a signal peptide is followed by a hemagglutinin (HA) peptide tag, a transmembrane domain and mCherry, all driven by the zebrafish hsp70 promoter (Fig. 1C).
