Sentence examples for covering the points from inspiring English sources
Discounted Cumulative Gain Anchor Set Cover (DCGASC): Discounting cumulative gain of covering the points which is also sub-modular and monotone.
By covering the points above, you will certainly help influence the process in your favour.
I put a comprehensive set of questions to the university covering the points made in this article.
That was followed by 75% of money backing Oklahoma covering the spread in its game versus VCU, 70% of the money going toward Texas A&M covering the points against Northern Iowa and 68% on Notre Dame covering against Stephen F. Austin.
First, we represent nonlinear systems into T-S fuzzy models in a working region covering the point to be regulated.
When I coached Montreal, Lafleur and Steve Shutt would be up near the blue line covering the point, trying to block shots so they could get free behind the defense.
There is a good reason why Sporting News, one of America's oldest sports publications founded in 1886, is covering the point spread for Super Bowl 51.
If the game could end with neither team winning, losing or covering the point spread, that would be just fine with the mother of both coaches.
Heterozygous and wild-type Edardl-J specimens exhibit similar external traits and were genotyped through PCR amplification of a 306 bp fragment covering the point mutation (primers: 5' GTCTCAGCCCCACCGAGTTG and 3' GTGGGGAGGCAGGTGGTACA), followed by sequencing.
At each point in the genome we calculated the proportion of pairs of individuals sharing an IBD segment covering the point (the IBD rate).
