Sentence examples for corresponded to position from inspiring English sources

Exact(5)

Position 600 in fungal enzymes, that corresponded to position 591 in human PFK-M was typically ocupied by non-ionizable amino acid residues with either polar or hydrophobic properties (Fig. 1B), but in lower animals the ionizable acidic residue aspartic acid was normally present (Fig. 1C).

The C2 breakpoint corresponded to position chr5:125,699,519 on the reference genome (all coordinates are for chr. 5).

The 843 bp EF1a sequence of H. haemorrhoidalis corresponded to position 598 1280 in the EF1a copy F1 of D. melanogaster [ 71, 72], and contained two introns.

This corresponded to position 2008 within the cDNA and would cause an arginine to cysteine change at position 650 in the protein product.

The T2 breakpoint corresponded to position 126,174,517 and it was flanked by a sequence that began at position 126,097,260 in direct orientation (J2, Fig. 3A).

Similar(55)

Panel letters correspond to position letter on CXR (subscript P for posterior chest wall and subscript L for lateral chest wall LUS interrogation).

Color corresponds to position in the sequence.

* Numbers corresponds to position in Figure 3.

The bisulphite modified antisense primer was (IRD 700 labelled) 5′ TGGGGGAGTTTAGTAGTGTTTATTG 3′, which corresponds to position −842 to −867.

The positions of the substitutions introduced corresponded to positions 72, 110, 113, 116, and 219 of the 93JP-NH1 p66.

181/260 predictions corresponded to positions that 'galign' read as having more wild-type than mutant reads, making it unlikely that most of these correspond to bona fide changes.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: