Sentence examples for correspond to position from inspiring English sources
Panel letters correspond to position letter on CXR (subscript P for posterior chest wall and subscript L for lateral chest wall LUS interrogation).
As can be seen (Figure 3C, lanes 12 16) extension products corresponding to 98, 99, 113 and 116 nucleotides designated as f, e, d and c respectively, could be observed which correspond to position −500, −501, −515, −518 from the start of dnaN gene.
Murine TRGC1 correspond to position 1 50000 of the GenBank entry [GenBank: AF037352].
The 5′ ends of the extension for SINEU-2B_Crp correspond to position 275 in the consensus sequence of MarinerN-4_AMi.
Horizontal axis corresponds to position relative to TSS.
Color corresponds to position in the sequence.
* Numbers corresponds to position in Figure 3.
The bisulphite modified antisense primer was (IRD 700 labelled) 5′ TGGGGGAGTTTAGTAGTGTTTATTG 3′, which corresponds to position −842 to −867.
The C2 breakpoint corresponded to position chr5:125,699,519 on the reference genome (all coordinates are for chr. 5).
This corresponded to position 2008 within the cDNA and would cause an arginine to cysteine change at position 650 in the protein product.
The x axis shows the position along the sequence and x = 0 corresponds to position +1, the start of the annotated gene or the putative transcription start site.
