Sentence examples for correlation collapse from inspiring English sources
Interestingly, three cancer-mutated genes had a similar differential co-expression pattern with YWHAZ, and all have a sharp correlation collapse in cirrhosis.
These results are reported in [ 49]. cWe report this correlation collapsed across WM-load conditions, as the correlations in the two conditions were virtually the same.
There was a good correlation between collapsed tissue provided by the EIT and CT (R2 = 0,97).
To examine the relationship between movement error and reaction or movement time, we conducted Pearson's correlation analysis (collapsed across hand conditions for purposes of simplification).
Its one graph, showing the correlation between the collapse of council house builds and massive house price inflation, is more memorable than all of the two dozen or so in All That Is Solid.
Design correlations for the collapse pressure and its relation to the cavitational yield have also been given which should assist the designers in the choice of the operating parameters for a desired cavitational effect.
An approach by taking the correlation among structural collapses into account in selecting the optimum upgrading level of a group of existing structures is presented and illustrated by a numerical example.
Incorporating a two- or three-day moving average would likely collapse these correlations, but such an approach would mask the weekday and SR indicator effects that figure prominently in the final models.
Primer sequences for DDR1 were forward primer ATGGAGCAACCACAGCTTCTC, reverse primer CTCAGCCGGTCAAACTCAAACT, and for DDR2, forward primer GGAGGTCATGGCATCGAGTT, reverse primer GAGTGCCATCCCGACTGTAATT. Technical replicates displayed high correlation (Ravg=0.95±0.03) and were collapsed by averaging.
Only nine common RNA bee viruses were identified by proteomics, and most occurred in only one or a few samples, with little correlation to the progression of collapse (Table 3).
Even in the most favourable situation in which we build a cryogenic setup to share the entanglement, we would have a collapse of the correlations after ∼10 m due to the detection inefficiency and losses.
