Sentence examples for correct different from inspiring English sources

In conclusion, transfixing wires protected in a hip spica cast represent a simple, easy, and reliable fixation method for valgus osteotomies performed to correct different varieties of pediatic coxa vara (even revision cases) with different degrees of severity.

Our objective was to explore the ability of the novel N2 mini-implant to be used as an orthopedic anchorage and to understand how different placement locations and force directions can be used to correct different types of class III malocclusions.

This would allow for procedural optimization and also standardization of which settings should be applied to correct different degrees of myopia.

In this study, we provide a novel strategy to correct different types of natural splicing mutations using exon specific U1 snRNAs (ExSpeU1).

Pediatric surgeons use operative techniques from different surgical fields to correct different kinds of pediatric conditions that may involve more than one organ.

A pilot survey preceded the main survey in order to detect and correct different problems of the questionnaire and its administration.

The substitution spectra for wild-type and MMR-deficient lines (Fig.  2) differed substantially, demonstrating that the MMR system corrects different classes of pre-mutations with different efficiencies.

A constant length code which corrects different numbers of errors in different code words is called a non-uniform error correcting code.

Primer sequences are available when required, GAPDH-1 (GCCCAATACGACCAAATCTAA) and GAPDH-2 (ATTGTTGCCATCAATGACCC) are the primers from two HindIII restriction fragments of the GAPDH gene used for correcting different template amount.

The DPIs obtained after correcting different amounts of defocus (−0.50 D, −0.25 D, + 0.25 D, + 0.50 D) induced by placing the corresponding trial lenses in front of the model eye were recorded.

An adaptive slant correction algorithm that is able to correct the different slant angles of the different components of a text line is presented.