The PCR primers were: FF4: GTAATAAGAGATTTTACCACTG; and FR7: TCAATTTCTGTTTTATCTAATTCCG (primer binding coordinates for the type F1 neurotoxin gene of strain Langeland are 1792 1813 and 3209 3233, respectively).
The coordinates of the different types of transcripts were obtained as described above.
We obtained Dm genome annotation and sequence Release 5.23 from Flybase [ 54] and parsed non-overlapping coordinates of the six types of gene features (promoters, 5' UTRs, CDS, introns, 3' UTRs and intergenic sequences) on each of the chromosomes in Dm from the genome annotation data (defining promoters as sequences extending 500 bp upstream of transcription start sites).
1,3,5,42 Atomic coordinates of the wild-type, methylated and hydroxymethylated DNA dodecamers examined in this work, based on Dickerson's well-studied self-complementary d(5'-CGCGAATTCGCG-3')2 sequence, were obtained from X-ray structures deposited in the Protein Data Bank (PDB IDs: 1BNA, 4GJU, 4GLG, 4GLH and 4GLC).
The global corner coordinates of the buildings, building type, number of stories, and other useful data can be read from GIS database, and the mass, stiffness, and rigidity matrices are automatically generated.
MDBs could be divided by three groups: MDBs for the image coordinates of GCPs (Type A), MDBs for the image coordinates of the keypoints that were matched in three images (Type B), and MDBs for the image coordinates of the keypoints that were matched in two images (Type C).
A plot of the sequence coordinates of both Type I and Type II markers on the chicken sequence assembly enabled the alignments of the integrated quail maps with chicken chromosomes, thus permitting the correct orientation and assignment of all the quail linkage groups.
To the end of well-posedness of Problem D1, the behavior of boundary functions in the vicinity of the points (P_{0}) and (P_{H}), in which the line of degeneracy crosses the bases of cylinder Q, must be coordinating with the type of degeneracy. 2.
The description in question is the region, the coordinates, the type of wound, the injured wound, the cut edge, the wound, the size of the wound, the network bridge, the objects and so forth.
The scattering pattern of the crystallographic coordinates of wild-type α-actinin-2 was calculated using CRYSOL (Svergun et al., 1995 ).
