Sentence examples for control pa from inspiring English sources

Exact(13)

Colocalization between BOLD changes and electrophysiology was assessed for significant changes on three comparisons between PA task and control conditions: PA compared with its fixation control, PA compared with ID and the PA fixation difference compared with the ID fixation difference.

Abbreviations: CWG, control; PA, Phragmites australis; PA dup., Phragmites australis system; PS Pistia stratiotes; PS dup., Pistia stratiotes system; LM, Lemna minor; AF, Azolla filiculoides; LS, Lactuca sativa.

Results showed that prawns fed the control, PA, FA or OAB diets often had increased hemocytes within the interstitial spaces, separation of the myoepithelial layer and epithelium, a near collapse of the tubule lumen and, in some cases, tubule rupture.

A stationary phase was observed on day 8 in the three mixotrophic groups in Phase I in which the OD680 value remained around 4.8 (~ 1.8 times that observed in the control PA).

Live animal luminescence imaging using the chemiluminescent reporter molecule luminol showed a significant reduction in inflammation at the site where particles were injected with Dex-PA compared to the site of injection for particles within a control PA in the same animal.

Figure 3a shows a control PA B-scan image.

Show more...

Similar(47)

Rats were divided into six groups (n=10 per group): 0.9% saline-injected rats (control); PA-injected rats (PAN); PA-injected ratreatedted with the selective dopamine D1-like receptor agonist zelandopam (30, 100, 300 mg/kg p.o. twice a day); PA-injected ratreatedted with prednisolone (1 mg/kg p.o. once a day).

The H&E staining of lung sections from control, Pa-LPS or CLP mice verify an age-related increase in inflammatory lung phenotype of adult mice as compared to the pediatric (Fig. 3B).

Compared to control, PA-2 1.5 × IC50 increased DCFDA by 76%, DHE by 51% and MitoSOX Red by 51% in MDA-MB-231 cells.

Specific primers for Periplaneta 18S ribosomal subunit were used as a positive control: Pa-18S forward 5′GTACCGGCGACGCATCTTTCA3′; Pa-18S reverse 5′CTTTCGGCCAGGCAGGACAC3′.

To investigate further the effect of NAT in controlling pA site usage of the sense gene, we perturbed the expression of NAT gene (KAT5) and then measured the pA site usage in RNASEH2C.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: