Sentence examples for contamination check from inspiring English sources

A pretakeoff contamination check is a check to make sure the wings and control surfaces are free of frost, ice, or snow.

(1) A pretakeoff contamination check, that has been established by the certificate holder and approved by the Administrator for the specific airplane type, has been completed within 5 minutes prior to beginning takeoff.

The adapter sequence used for the contamination check was as follows: CGAGATCGGAAGAGCACACGTC, i.e. meCG end repair ± A tail ± 10 bp of Illumina adapter sequence.

As this automated platform incorporates batch extraction in a 12 × 8 grid format 10% of all samples constituted HPV negative internal quality control material, the grid reference of which varied across batches as a contamination check.

Prepared libraries have undergone a quality control using an Agilent 2100 Bioanalyzer: DNA 1000 Labchip, Quant-iT dSDNA HS Assay for quantification and Quant-iT RNA Assay and Quant-iT Protein Assay for percentage contamination check, using an Invitrogen Qubit® Fluorometer.

Although Congress is now fully back in business, many office buildings remain closed until the contamination checks are finished.

Although Congress is now fully back in business, the office buildings remain closed until the contamination checks are finished.

Moreover, the OCSQ Order and Cleanliness and Hoarding dimensions are associated with their symptom counterparts (i.e., contamination, checking, order, hoarding and neutralizing).

Contamination checks were carried out during IODP Expedition 338, but no signs for contamination at the mist and moisture remover were found [25].

At least in our laboratory, quality and contamination checks are also performed during expansion of Tregs.

This includes mainly two kinds of tests: quality and contamination checks.