Sentence examples for containing the restriction from inspiring English sources

Exact(19)

Governor Ventura had threatened to veto any bill containing the restriction.

Candidate RAD loci and RAD alleles were defined based on the read containing the restriction site overhang, ignoring the paired-end read.

COQ7 promoter region was first cloned into pGEM-T Easy Vector (Promega) using primers containing the restriction enzyme sites for SacI (5') and HindIII (3'): hCQ7pSacIF (GTAGAGCTCTCCAAGGGTGTAA), CQ7pHindIIIR (GTTAAGCTTGTCCTGTTCACAG), for pGL3-1, and hCQ7pSacI3 (GTAGAGCTCACAGAGGGAGG) and CQ7pHindIIIR for pGL3-2.

In order to express intramolecular sequences of luk-PV or signal peptides, the promoter and terminator regions were cloned onto pSK265 separated by a short cloning sequence containing the restriction sites EcoRV and BamHI (Tables 1 and 2).

This fragment was amplified with the primers containing the restriction site of ClaI and XhoI respectively in their flanking regions, (primers Delt-3F: 5'-CCATCGATGACTAG- andAATGAAGGGTGTT-3' and Delt-3R: 5'-CGGCTCGAGTAAGAAGACTGTTGA- TACCG-3'), to create pNeo2CCTδ.

This fragment was amplified with the primers Alf-3F and Alf-3R containing the restriction site of ClaI and XhoI respectively in their flanking regions, (primers Alf-3F:5'-CCATCGATGAATGTGCTGAAGTTTACGA-3' and Alf-3R: 5'-CGGCTCGAGCCCATTCTACATCTTATCC -3'), to create the plasmid pNeo2CCTα.

Show more...

Similar(41)

Because the deed containing the restrictions had been recorded, Banc One had actual or constructive notice of the reversion that was created when the Brashlers mortgaged the property.

Senate Republicans and the administration strongly objected to the provision, and Defense Secretary Donald H. Rumsfeld recommended that President Bush veto the spending bill if it contained the restriction.

The record further contained the restriction that the film could not be shown for profit nor could "ownership be transferred" from Harvard to a third party.

The gdh gene was amplified from the genomic DNA with specific primers GDHFw (5′-TGGATCC ATGCAACCGATTCGTCTCG-3′) and GDHRev (5′-GCGAAGCTT TTAATCGTAGAACGGC-3′), which contained the restriction sites for Bam HI and Hin dIII, respectively.

The oligonucleotides contained the restriction sites HindIII and NcoI.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: